pJS032
(Plasmid
#135431)
-
PurposeYeast integrating plasmid to express PYL1-VP64
-
Depositing Lab
-
Depositing OrganizationUniversity of Washington
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJW609
- Total vector size (bp) 9809
-
Vector typeYeast Expression
-
Selectable markersKanMX (G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePYL1-VP64
-
Insert Size (bp)768
- Promoter pAdh
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCCTCGTCATTGTTCTCG
- 3′ sequencing primer AATATCGCACTCACGTAAACACTTAATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJS032 was a gift from Jesse Zalatan (Addgene plasmid # 135431 ; http://n2t.net/addgene:135431 ; RRID:Addgene_135431) -
For your References section:
CRISPR-Cas-Mediated Chemical Control of Transcriptional Dynamics in Yeast. Cunningham-Bryant D, Sun J, Fernandez B, Zalatan JG. Chembiochem. 2019 Jun 14;20(12):1519-1523. doi: 10.1002/cbic.201800823. Epub 2019 Apr 26. 10.1002/cbic.201800823 PubMed 30710419