L1_lacZgRNA-Ck3
(Plasmid
#136136)
-
PurposeL1 in position 3, to clone gRNA target using BbsI, lacZ blue-white screening
-
Depositing Lab
-
Depositing OrganizationUniversity of Cambridge
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136136 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCk3
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep5-MpU6:lacZgRNA
-
gRNA/shRNA sequencescaffold: tttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
-
SpeciesMarchantia polymorpha
-
MutationBsaI/ SapI domesticated
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.02.29.971002v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
L1_lacZgRNA-Ck3 was a gift from Jim Haseloff (Addgene plasmid # 136136 ; http://n2t.net/addgene:136136 ; RRID:Addgene_136136) -
For your References section:
Systematic tools for reprogramming plant gene expression in a simple model, Marchantia polymorpha. Sauret-Gueto S, Frangedakis E, Silvestri L, Rebmann M, Tomaselli M, Markel K, Delmans M, West A, Patron NJ, Haseloff J. ACS Synth Biol. 2020 Mar 12. doi: 10.1021/acssynbio.9b00511. 10.1021/acssynbio.9b00511 PubMed 32163700