pCDNA4.TO-ORF16-2xCSTREP
(Plasmid
#136176)
-
PurposeExpresses C-terminally strep tagged Kaposi's Sarcoma Associated Herpesvirus (KSHV) ORF16
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136176 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 136176-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 136176-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCDNA4.TO
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameORF16
-
SpeciesKaposi's sarcoma-associated herpesvirus (KSHV)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGGCT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA of reactivated TREx BCBL-1-RTA cells
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 136176-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 136176-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA4.TO-ORF16-2xCSTREP was a gift from Britt Glaunsinger (Addgene plasmid # 136176 ; http://n2t.net/addgene:136176 ; RRID:Addgene_136176) -
For your References section:
Global mapping of herpesvirus-host protein complexes reveals a transcription strategy for late genes. Davis ZH, Verschueren E, Jang GM, Kleffman K, Johnson JR, Park J, Von Dollen J, Maher MC, Johnson T, Newton W, Jager S, Shales M, Horner J, Hernandez RD, Krogan NJ, Glaunsinger BA. Mol Cell. 2015 Jan 22;57(2):349-60. doi: 10.1016/j.molcel.2014.11.026. Epub 2014 Dec 24. 10.1016/j.molcel.2014.11.026 PubMed 25544563