Skip to main content

pCDNA4.TO-ORF74-2xNSTREP
(Plasmid #136233)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136233 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 136233-D50 50 μg of DNA in Tris buffer $495
DNA 136233-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCDNA4.TO
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ORF74
  • Species
    Kaposi's sarcoma-associated herpesvirus (KSHV)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA of reactivated TREx BCBL-1-RTA cells

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA4.TO-ORF74-2xNSTREP was a gift from Britt Glaunsinger (Addgene plasmid # 136233 ; http://n2t.net/addgene:136233 ; RRID:Addgene_136233)
  • For your References section:

    Global mapping of herpesvirus-host protein complexes reveals a transcription strategy for late genes. Davis ZH, Verschueren E, Jang GM, Kleffman K, Johnson JR, Park J, Von Dollen J, Maher MC, Johnson T, Newton W, Jager S, Shales M, Horner J, Hernandez RD, Krogan NJ, Glaunsinger BA. Mol Cell. 2015 Jan 22;57(2):349-60. doi: 10.1016/j.molcel.2014.11.026. Epub 2014 Dec 24. 10.1016/j.molcel.2014.11.026 PubMed 25544563