pTJK368
(Plasmid
#138006)
-
PurposeBirA* expression. Vector also expresses GFP under control of hUBC promoter
-
Depositing Lab
-
Depositing OrganizationUniversity of Maryland, Baltimore
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepWCC43
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable ; Stellar Cells
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBirA*
-
SpeciesE. coli
-
MutationNone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (unknown if destroyed)
- 3′ cloning site Sal1 (unknown if destroyed)
- 5′ sequencing primer TTCATTCTCAAGCCTCAGAC
- 3′ sequencing primer GGACGCTCGCTGCGCCCTTCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBirA* denotes BirA harboring R118G and is derived from Addgene plasmid 35700
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTJK368 was a gift from Tami Kingsbury (Addgene plasmid # 138006 ; http://n2t.net/addgene:138006 ; RRID:Addgene_138006)