Skip to main content

pLVX neo PFKL-GFP
(Plasmid #138289)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138289 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLVX neo
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8140
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PFKL
  • Alt name
    ATP-dependent 6-phosphofructokinase, liver type
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2343
  • Entrez Gene
    PFKL (a.k.a. ATP-PFK, PFK-B, PFK-L)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CMV forward: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer IRES-R: CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Thermo Ultimate lite Orfeome library: IOH6888; pENTR(tm)221

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX neo PFKL-GFP was a gift from Gaudenz Danuser (Addgene plasmid # 138289 ; http://n2t.net/addgene:138289 ; RRID:Addgene_138289)
  • For your References section:

    Mechanical regulation of glycolysis via cytoskeleton architecture. Park JS, Burckhardt CJ, Lazcano R, Solis LM, Isogai T, Li L, Chen CS, Gao B, Minna JD, Bachoo R, DeBerardinis RJ, Danuser G. Nature. 2020 Feb 12. pii: 10.1038/s41586-020-1998-1. doi: 10.1038/s41586-020-1998-1. 10.1038/s41586-020-1998-1 PubMed 32051585