pLVX neo PFKL-GFP, K272R
(Plasmid
#138290)
-
PurposeMammalian Expression, Lentiviral. Expression of human phosphofructokinase, liver isoform PFKL-GFP, K272R, fusion protein
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas Southwestern Medical Center
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138290 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLVX neo
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 8140
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePFKL
-
Alt nameATP-dependent 6-phosphofructokinase, liver type
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2343
-
MutationK272R
-
Entrez GenePFKL (a.k.a. ATP-PFK, PFK-B, PFK-L)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CMV forward: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer IRES-R: CCTCACATTGCCAAAAGACG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThermo Ultimate lite Orfeome library: IOH6888; pENTR(tm)221
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX neo PFKL-GFP, K272R was a gift from Gaudenz Danuser (Addgene plasmid # 138290 ; http://n2t.net/addgene:138290 ; RRID:Addgene_138290) -
For your References section:
Mechanical regulation of glycolysis via cytoskeleton architecture. Park JS, Burckhardt CJ, Lazcano R, Solis LM, Isogai T, Li L, Chen CS, Gao B, Minna JD, Bachoo R, DeBerardinis RJ, Danuser G. Nature. 2020 Feb 12. pii: 10.1038/s41586-020-1998-1. doi: 10.1038/s41586-020-1998-1. 10.1038/s41586-020-1998-1 PubMed 32051585