pHIE043 ZF43x1 mKate2 (TUPV1)
(Plasmid
#138723)
-
PurposemMoClo TUPV, with ZF43x1 promoter and mKate2 in the MCS
-
Depositing Lab
-
Depositing OrganizationNorthwestern University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepPD561 TUPV1 CAG
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZF43x1
-
SpeciesSynthetic
- Promoter ZF43x1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CGACACGGAAATGTTGAATAC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Leonard lab plasmid reference number: L1525
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHIE043 ZF43x1 mKate2 (TUPV1) was a gift from Joshua Leonard (Addgene plasmid # 138723 ; http://n2t.net/addgene:138723 ; RRID:Addgene_138723) -
For your References section:
The COMET toolkit for composing customizable genetic programs in mammalian cells. Donahue PS, Draut JW, Muldoon JJ, Edelstein HI, Bagheri N, Leonard JN. Nat Commun. 2020 Feb 7;11(1):779. doi: 10.1038/s41467-019-14147-5. 10.1038/s41467-019-14147-5 PubMed 32034124