pCFD3-dUG-DH1
(Plasmid
#138963)
-
PurposeUsed to edit the endogenous Drosophila kkv gene to encode a fluorescent Chitin Synthase.
-
Depositing Lab
-
Depositing OrganizationUniversity of Virginia
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCFD3-dUG
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDH1 oligo
-
gRNA/shRNA sequenceGTCGCTGGTGGTGCGGGTGGGGATGTTT
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site Bbs1 (destroyed during cloning)
- 5′ sequencing primer ccagactcagttcg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/718841v3 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD3-dUG-DH1 was a gift from Paul Adler (Addgene plasmid # 138963 ; http://n2t.net/addgene:138963 ; RRID:Addgene_138963) -
For your References section:
The localization of chitin synthase mediates the patterned deposition of chitin in developing Drosophila bristles. Adler PN. bioRxiv 2020 10.1101/718841