pMT406
(Plasmid
#139384)
-
PurposeRPU standard, pNBU1 backbone with BsaI sites, AmpR, ErmR
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139384 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepNBU1
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRPU standard
- Promoter No promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aacgcactgagaagccctta
- 3′ sequencing primer tgagcaacaaggaatccaaca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMT406 was a gift from Christopher Voigt (Addgene plasmid # 139384 ; http://n2t.net/addgene:139384 ; RRID:Addgene_139384) -
For your References section:
Genetic circuit design automation for the gut resident species Bacteroides thetaiotaomicron. Taketani M, Zhang J, Zhang S, Triassi AJ, Huang YJ, Griffith LG, Voigt CA. Nat Biotechnol. 2020 Aug;38(8):962-969. doi: 10.1038/s41587-020-0468-5. Epub 2020 Mar 30. 10.1038/s41587-020-0468-5 PubMed 32231334