pMT469
(Plasmid
#139395)
-
PurposeNanoluc placed on Output 1 of the 2in3out circuit (A001 and P002 design) with aTC and Bile Acid as inputs, AmpR, ErmR
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 139395-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 139395-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepNBU1
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNanoluc placed on Output 1 of the 2in3out circuit (A001 and P002 design) with aTC and Bile Acid as inputs
- Promoter aTC and BA inducible promoters
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aacgcactgagaagccctta
- 3′ sequencing primer tgagcaacaaggaatccaaca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 139395-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 139395-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMT469 was a gift from Christopher Voigt (Addgene plasmid # 139395 ; http://n2t.net/addgene:139395 ; RRID:Addgene_139395) -
For your References section:
Genetic circuit design automation for the gut resident species Bacteroides thetaiotaomicron. Taketani M, Zhang J, Zhang S, Triassi AJ, Huang YJ, Griffith LG, Voigt CA. Nat Biotechnol. 2020 Aug;38(8):962-969. doi: 10.1038/s41587-020-0468-5. Epub 2020 Mar 30. 10.1038/s41587-020-0468-5 PubMed 32231334
