phR-Luc
(Plasmid
#139644)
-
PurposeMammalian gene expression
-
Depositing Lab
-
Depositing OrganizationUniversity of Helsinki
Located in Finland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139644 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 139644-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 139644-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL4.73
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRenilla luciferase
-
SpeciesH. sapiens (human)
- Promoter SV40
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer RVprimer3
- 3′ sequencing primer primers designed based on sequences
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' Cloning Site: 5' CTAGCAAAATAGGCTGTCCC
DNA (Catalog # 139644-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 139644-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
phR-Luc was a gift from Markku Varjosalo (Addgene plasmid # 139644 ; http://n2t.net/addgene:139644 ; RRID:Addgene_139644) -
For your References section:
PTPRA Phosphatase Regulates GDNF-Dependent RET Signaling and Inhibits the RET Mutant MEN2A Oncogenic Potential. Yadav L, Pietila E, Ohman T, Liu X, Mahato AK, Sidorova Y, Lehti K, Saarma M, Varjosalo M. iScience. 2020 Feb 21;23(2):100871. doi: 10.1016/j.isci.2020.100871. Epub 2020 Jan 31. 10.1016/j.isci.2020.100871 PubMed 32062451