Skip to main content

phR-Luc
(Plasmid #139644)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139644 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 139644-D50 50 μg of DNA in Tris buffer $495
DNA 139644-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL4.73
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Renilla luciferase
  • Species
    H. sapiens (human)
  • Promoter SV40

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer RVprimer3
  • 3′ sequencing primer primers designed based on sequences
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' Cloning Site: 5' CTAGCAAAATAGGCTGTCCC

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phR-Luc was a gift from Markku Varjosalo (Addgene plasmid # 139644 ; http://n2t.net/addgene:139644 ; RRID:Addgene_139644)
  • For your References section:

    PTPRA Phosphatase Regulates GDNF-Dependent RET Signaling and Inhibits the RET Mutant MEN2A Oncogenic Potential. Yadav L, Pietila E, Ohman T, Liu X, Mahato AK, Sidorova Y, Lehti K, Saarma M, Varjosalo M. iScience. 2020 Feb 21;23(2):100871. doi: 10.1016/j.isci.2020.100871. Epub 2020 Jan 31. 10.1016/j.isci.2020.100871 PubMed 32062451