SPACE-ΔUGI (pRZ1836)
(Plasmid
#140243)
-
PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9-pmCDA1(R187W)-P2A-EGFP
-
Depositing Lab
-
Depositing OrganizationMassachusetts General Hospital
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140243 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 140243-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 140243-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneCMV
-
Backbone manufacturerpCMV-ABEmax-P2A-EGFP (Addgene #112101)
- Backbone size w/o insert (bp) 3400
- Total vector size (bp) 9750
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSPACE-ΔUGI
-
Alt namebpNLS-TadA*(V82G)-nCas9-bpNLS-pmCDA1(R187W)-P2A-EGFP
-
SpeciesE. coli, S. pyogenes, P. marinus
-
Insert Size (bp)6385
-
MutationV82G in TadA*, D10A in Cas9, R187W in pmCDA1
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene #131313, #131300
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 140243-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 140243-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SPACE-ΔUGI (pRZ1836) was a gift from Keith Joung (Addgene plasmid # 140243 ; http://n2t.net/addgene:140243 ; RRID:Addgene_140243) -
For your References section:
A dual-deaminase CRISPR base editor enables concurrent adenine and cytosine editing. Grunewald J, Zhou R, Lareau CA, Garcia SP, Iyer S, Miller BR, Langner LM, Hsu JY, Aryee MJ, Joung JK. Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0535-y. doi: 10.1038/s41587-020-0535-y. 10.1038/s41587-020-0535-y PubMed 32483364