Skip to main content

miniCGBE1 (pBM1219)
(Plasmid #140253)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140253 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 140253-D50 50 μg of DNA in Tris buffer $495
DNA 140253-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    CMV
  • Backbone manufacturer
    pCMV-ABEmax-P2A-EGFP (Addgene #112101)
  • Backbone size w/o insert (bp) 3400
  • Total vector size (bp) 9195
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BE4max(R33A)-ΔUGI
  • Alt name
    bpNLS-rAPOBEC1(R33A)-nCas9-bpNLS-P2A-EGFP
  • Species
    R. norvegicus (rat); S. pyogenes
  • Insert Size (bp)
    5930
  • Mutation
    R33A in rAPOBEC1, D10A in Cas9
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene #140251

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    miniCGBE1 (pBM1219) was a gift from Keith Joung (Addgene plasmid # 140253 ; http://n2t.net/addgene:140253 ; RRID:Addgene_140253)
  • For your References section:

    CRISPR C-to-G base editors for inducing targeted DNA transversions in human cells. Kurt IC, Zhou R, Iyer S, Garcia SP, Miller BR, Langner LM, Grunewald J, Joung JK. Nat Biotechnol. 2020 Jul 20. pii: 10.1038/s41587-020-0609-x. doi: 10.1038/s41587-020-0609-x. 10.1038/s41587-020-0609-x PubMed 32690971