CAG::TdTomato
(Plasmid
#140504)
-
PurposeEncodes TdTomato driven by the CAG promoter
-
Depositing Lab
-
Depositing OrganizationThe City University of New York (CUNY) on behalf of City College of New York
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140504 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneStatia
- Backbone size w/o insert (bp) 7305
- Total vector size (bp) 9006
-
Vector typeMammalian Expression ; Chicken Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCAG promoter
-
Insert Size (bp)1701
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site EcorI (not destroyed)
- 5′ sequencing primer GTTCCGCGCACATTTCCCCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCAG from Addgene plasmid #14757
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid has been modified by removal of the ires-SEAP cassette from the plasmid published originally, but the modifications are not of concern for plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG::TdTomato was a gift from Mark Emerson (Addgene plasmid # 140504 ; http://n2t.net/addgene:140504 ; RRID:Addgene_140504) -
For your References section:
Lineage tracing analysis of cone photoreceptor associated cis-regulatory elements in the developing chicken retina. Schick E, McCaffery SD, Keblish EE, Thakurdin C, Emerson MM. Sci Rep. 2019 Jun 27;9(1):9358. doi: 10.1038/s41598-019-45750-7. 10.1038/s41598-019-45750-7 PubMed 31249345