Skip to main content
Addgene
Open Menu

nSaCas9 N730-hAIDx
(Plasmid #140598)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140598 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 10150
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human Activation-Induced Cytidine Deaminase
  • Alt name
    hAIDx (P182X)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4722
  • Mutation
    P182X truncation; D10A in SaCas9
  • Entrez Gene
    AICDA (a.k.a. AID, ARP2, CDA2, HEL-S-284, HIGM2)
  • Promoter CMV
  • Tag / Fusion Protein
    • P2A cleavable sequence with blasticidine resistance gene fragment (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aagcgaaattacattctggggctggccattggcattacatcagtgggc
  • 3′ sequencing primer gtcaagagcaagaaacatcctcagattat
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Genscript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nSaCas9 N730-hAIDx was a gift from Alex Hewitt (Addgene plasmid # 140598)

  • For your References section:

    Engineering domain-inlaid SaCas9 adenine base editors with reduced RNA off-targets and increased on-target DNA editing. Nguyen Tran MT, Mohd Khalid MKN, Wang Q, Walker JKR, Lidgerwood GE, Dilworth KL, Lisowski L, Pebay A, Hewitt AW. Nat Commun. 2020 Sep 25;11(1):4871. doi: 10.1038/s41467-020-18715-y. 10.1038/s41467-020-18715-y PubMed 32978399
Related items: