Skip to main content

pXG290
(Plasmid #141284)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141284 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 141284-D50 50 μg of DNA in Tris buffer $495
DNA 141284-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    safe-harbor-expression
  • Backbone size w/o insert (bp) 4359
  • Total vector size (bp) 8230
  • Vector type
    Mammalian Expression
  • Selectable markers
    fluorescent

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HRI
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3871
  • Entrez Gene
    EIF2AK1 (a.k.a. HCR, HRI, LEMSPAD, hHRI)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mClover

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site speI (not destroyed)
  • 3′ cloning site mluI (not destroyed)
  • 5′ sequencing primer cattatacgaagttattcgacattg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXG290 was a gift from Martin Kampmann (Addgene plasmid # 141284 ; http://n2t.net/addgene:141284 ; RRID:Addgene_141284)
  • For your References section:

    Mitochondrial stress is relayed to the cytosol by an OMA1-DELE1-HRI pathway. Guo X, Aviles G, Liu Y, Tian R, Unger BA, Lin YT, Wiita AP, Xu K, Correia MA, Kampmann M. Nature. 2020 Mar;579(7799):427-432. doi: 10.1038/s41586-020-2078-2. Epub 2020 Mar 4. 10.1038/s41586-020-2078-2 PubMed 32132707