-
PurposeOE of HRI
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141284 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 141284-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 141284-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonesafe-harbor-expression
- Backbone size w/o insert (bp) 4359
- Total vector size (bp) 8230
-
Vector typeMammalian Expression
-
Selectable markersfluorescent
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHRI
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3871
-
Entrez GeneEIF2AK1 (a.k.a. HCR, HRI, LEMSPAD, hHRI)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mClover
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site speI (not destroyed)
- 3′ cloning site mluI (not destroyed)
- 5′ sequencing primer cattatacgaagttattcgacattg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 141284-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 141284-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXG290 was a gift from Martin Kampmann (Addgene plasmid # 141284 ; http://n2t.net/addgene:141284 ; RRID:Addgene_141284) -
For your References section:
Mitochondrial stress is relayed to the cytosol by an OMA1-DELE1-HRI pathway. Guo X, Aviles G, Liu Y, Tian R, Unger BA, Lin YT, Wiita AP, Xu K, Correia MA, Kampmann M. Nature. 2020 Mar;579(7799):427-432. doi: 10.1038/s41586-020-2078-2. Epub 2020 Mar 4. 10.1038/s41586-020-2078-2 PubMed 32132707