EGFP-CCHD (p130Cas)
(Plasmid
#145132)
-
PurposeExpresses CCH domain from p130Cas with an EGFP tag
-
Depositing Lab
-
Depositing OrganizationUniversity of Turku
Located in Finland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 145132 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 145132-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 145132-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneEGFP
- Total vector size (bp) 5172
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep130Cas CCH domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)483
-
Entrez GeneBCAR1 (a.k.a. CAS, CAS1, CASS1, CRKAS, P130Cas)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GGCTGATTATGATCAGTTATCTAGATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 145132-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 145132-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-CCHD (p130Cas) was a gift from Johanna Ivaska (Addgene plasmid # 145132 ; http://n2t.net/addgene:145132 ; RRID:Addgene_145132) -
For your References section:
Filopodome Mapping Identifies p130Cas as a Mechanosensitive Regulator of Filopodia Stability. Jacquemet G, Stubb A, Saup R, Miihkinen M, Kremneva E, Hamidi H, Ivaska J. Curr Biol. 2019 Jan 21;29(2):202-216.e7. doi: 10.1016/j.cub.2018.11.053. Epub 2019 Jan 10. 10.1016/j.cub.2018.11.053 PubMed 30639111