Skip to main content

BFP-Dcp1a
(Plasmid #153973)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153973 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 153973-D50 50 μg of DNA in Tris buffer $495
DNA 153973-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pAcGFP-c1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4721
  • Total vector size (bp) 6429
  • Modifications to backbone
    GFP was replaced with BFP (mTagBFP-c1) using XhoI and KpnI
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mRNA decapping enzyme 1a
  • Alt name
    Dcp1a
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1746
  • Entrez Gene
    DCP1A (a.k.a. HSA275986, Nbla00360, SMAD4IP1, SMIF)
  • Tag / Fusion Protein
    • mTagBFP-c1 (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGAGACCTACGTCGAGCAGC
  • 3′ sequencing primer GGTGTGGGAGGTTTTTTAAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BFP-Dcp1a was a gift from Gia Voeltz (Addgene plasmid # 153973 ; http://n2t.net/addgene:153973 ; RRID:Addgene_153973)
  • For your References section:

    Endoplasmic reticulum contact sites regulate the dynamics of membraneless organelles. Lee JE, Cathey PI, Wu H, Parker R, Voeltz GK. Science. 2020 Jan 31;367(6477). pii: 367/6477/eaay7108. doi: 10.1126/science.aay7108. 10.1126/science.aay7108 PubMed 32001628