XLone-Puro Cas13d-eGFP U6 SOX17 g2
(Plasmid
#155188)
-
PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and SOX17 gRNA2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155188 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAddgene plasmid #155184
- Backbone size w/o insert (bp) 9817
- Total vector size (bp) 9822
-
Vector typeMammalian Expression ; Piggybac transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas13d SOX17 gRNA2
-
gRNA/shRNA sequenceTAAGATTACTTGAAGTAGGCTCA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2898
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT
- 3′ sequencing primer M13 RVS
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
XLone-Puro Cas13d-eGFP U6 SOX17 g2 was a gift from Xiaoping Bao (Addgene plasmid # 155188 ; http://n2t.net/addgene:155188 ; RRID:Addgene_155188) -
For your References section:
Chemically-defined generation of human hemogenic endothelium and definitive hematopoietic progenitor cells. Chang Y, Syahirah R, Oprescu SN, Wang X, Jung J, Cooper SH, Torregrosa-Allen S, Elzey BD, Hsu AY, Randolph LN, Sun Y, Kuang S, Broxmeyer HE, Deng Q, Lian X, Bao X. Biomaterials. 2022 May 6;285:121569. doi: 10.1016/j.biomaterials.2022.121569. 10.1016/j.biomaterials.2022.121569 PubMed 35567999