Dox human Citron shRNA 1 mKate
(Plasmid
#155293)
-
PurposeLentivirus for doxycycline inducible expression of nontargeting shRNA, mKate marker, based on Addgene 11652
-
Depositing Lab
-
Depositing OrganizationUniversity of Pennsylvania
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155293 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAddgene #11652
-
Modifications to backboneHuman Citron shRNA from PMID: 16431929 mKate replaces GFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCitron
-
gRNA/shRNA sequenceATGGAAGGCACTATTTCTCAA
-
SpeciesH. sapiens (human)
-
Entrez GeneCIT (a.k.a. CITK, CRIK, MCPH17, STK21)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dox human Citron shRNA 1 mKate was a gift from Martin Carroll (Addgene plasmid # 155293 ; http://n2t.net/addgene:155293 ; RRID:Addgene_155293)