pLenti-PGK-RAP1A-E63-neo
(Plasmid
#156174)
-
PurposeLentiviral vector for expression of RAP1A-E63, with neomycin selection
-
Depositing Lab
-
Depositing OrganizationIcahn School of Medicine at Mount Sinai
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 156174 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti PGK Neo DEST (w531-1)
-
Backbone manufacturerCampeau lab (addgene #19067)
- Backbone size w/o insert (bp) 9778
- Total vector size (bp) 8730
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRAP1A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)555
-
Mutationchanged Glutamine 63 to Glutamic acid
-
GenBank IDNM_001291896
-
Entrez GeneRAP1A (a.k.a. C21KG, G-22K, KREV-1, KREV1, RAP1, SMGP21)
- Promoter human PGK
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer PGK_F (GTGTTCCGCATTCTGCAAG)
- 3′ sequencing primer WPRE_R (CATAGCGTAAAAGGAGCAACA)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRAP1A-E63 was cloned using Addgene ID #32698, pAXEF-Rap1-E63(GTP)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
RAP1A-E63 cDNA was amplified by PCR and cloned into pENTR DTOPO and transferred by Gateway cloning into Desination vector. bioRxiv 10.1101/792077
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-PGK-RAP1A-E63-neo was a gift from Roland Friedel (Addgene plasmid # 156174 ; http://n2t.net/addgene:156174 ; RRID:Addgene_156174) -
For your References section:
Plexin-B2 orchestrates collective stem cell dynamics via actomyosin contractility, cytoskeletal tension and adhesion. Junqueira Alves C, Dariolli R, Haydak J, Kang S, Hannah T, Wiener RJ, DeFronzo S, Tejero R, Gusella GL, Ramakrishnan A, Alves Dias R, Wojcinski A, Kesari S, Shen L, Sobie EA, Rodrigues Furtado de Mendonca JP, Azeloglu EU, Zou H, Friedel RH. Nat Commun. 2021 Oct 14;12(1):6019. doi: 10.1038/s41467-021-26296-7. 10.1038/s41467-021-26296-7 PubMed 34650052