Skip to main content

pT7-pelB
(Plasmid #157740)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157740 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pET-20b
  • Backbone manufacturer
    EMD Millipore
  • Backbone size (bp) 3658
  • Modifications to backbone
    silent mutation in Leu14 in PelB signal sequence, in comparison to pET-20b
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tags / Fusion Proteins
    • PelB signal sequence (N terminal on backbone)
    • possible His6-tag (adds LEHHHHHH) if no stop codon is added to the cloned insert (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

- Similar to pET-20b in that the vector encodes an N-terminal PelB signal sequence, but has the added advantage over pET-20b in leaving no added amino acid residues following in vivo cleavage of the PelB signal sequence by the cell’s signal peptidase. This advantage is made possible by cloning into the two BseRI restriction sites.
- Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, CAGCCGGCGATGGCC, to the 5' end of the PCR FORWARD primer, and add these 15 bp, GTGGTGGTGCTCGAG, to the 5' end of the PCR REVERSE primer.
- The sequence of the added N-terminus is the PelB signal sequence: MKYLLPTAAAGLLLLAAQPAMA.
- The PelB signal sequence directs the protein of interest to the E. coli inner membrane. Whether the protein traverses the inner membrane is dependent on the protein of interest.
- A C-terminal His6-tag is possible: if no stop codon is included in the cloned insert, the sequence LEHHHHHH is added to the C-terminus.
- BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone.
- To verify the PCR-generated insert sequence, use sequencing primers T7 (TAATACGACTCACTATAGGG), T7-Ter (GCTAGTTATTGCTCAGCGG).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-pelB was a gift from Debra Hansen (Addgene plasmid # 157740 ; http://n2t.net/addgene:157740 ; RRID:Addgene_157740)