sgRNA targeting human SLC12A5 gene stop codon
(Plasmid
#158577)
-
PurposeFor generate double-strand DNA break near the stop codon of the human SLC12A5 gene that encodes neuronal chloride transporter KCC2 protein.
-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneCas9-PolyA-CMV-GFP
- Backbone size w/o insert (bp) 9300
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting human SLC12A5 gene stop codon
-
gRNA/shRNA sequenceACCATCTACTCCTGAGAACC
-
SpeciesH. sapiens (human)
-
Tag
/ Fusion Protein
- Cas9 and GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer pLKO
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA targeting human SLC12A5 gene stop codon was a gift from Rudolf Jaenisch (Addgene plasmid # 158577 ; http://n2t.net/addgene:158577 ; RRID:Addgene_158577) -
For your References section:
Pharmacological enhancement of KCC2 gene expression exerts therapeutic effects on human Rett syndrome neurons and Mecp2 mutant mice. Tang X, Drotar J, Li K, Clairmont CD, Brumm AS, Sullins AJ, Wu H, Liu XS, Wang J, Gray NS, Sur M, Jaenisch R. Sci Transl Med. 2019 Jul 31;11(503). pii: 11/503/eaau0164. doi: 10.1126/scitranslmed.aau0164. 10.1126/scitranslmed.aau0164 PubMed 31366578