pRS423-GPD-wrmScarlet1-10-CYC1 terminator
(Plasmid
#158584)
-
PurposeExpresses wrmScarlet1-10 in S. cerevisiae
-
Depositing Lab
-
Depositing OrganizationCalico Life Sciences LLC
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRS423
- Backbone size w/o insert (bp) 6682
- Total vector size (bp) 7306
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namewrmScarlet1-10
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)624
- Promoter GPD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gacggtaggtattgattgtaattctg
- 3′ sequencing primer ggcgtgaatgtaagcgtgac
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bygene synthesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS423-GPD-wrmScarlet1-10-CYC1 terminator was a gift from Cynthia Kenyon (Addgene plasmid # 158584 ; http://n2t.net/addgene:158584 ; RRID:Addgene_158584) -
For your References section:
Split-wrmScarlet and split-sfGFP: tools for faster, easier fluorescent labeling of endogenous proteins in Caenorhabditis elegans. Goudeau J, Sharp CS, Paw J, Savy L, Leonetti MD, York AG, Updike DL, Kenyon C, Ingaramo M. Genetics. 2021 Apr 15;217(4). pii: 6126424. doi: 10.1093/genetics/iyab014. 10.1093/genetics/iyab014 PubMed 33693628