p35S::SP-mCherry-GFP-HDEL
(Plasmid
#159097)
-
PurposePositive control for FRET in plant ER / nuclear envelope.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159097 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepB7FWG2
-
Backbone manufacturerGhent
- Backbone size w/o insert (bp) 11628
- Total vector size (bp) 11495
-
Modifications to backboneIntroduction of SP-mCherry-GFP-HDEL for FRET positive control
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSP-mCherry-GFP-HDEL
-
SpeciesSynthetic
-
Insert Size (bp)1528
- Promoter 35S
-
Tag
/ Fusion Protein
- mCherry, GFP
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ctgttccacgatggtgtagtcc
- 3′ sequencing primer ctgttccacgatggtgtagtcc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene QC NGS and diagnostic digest data shows a larger than expected plasmid sequence, relative to the sequence provided by the depositing laboratory, including a potential duplication of the insert sequence.
This construct is used as an positive control for apFRET in the ER or outer nuclear envelope in plant cells. The mCherry and GFP are fused by a GGSGG amino acid linker.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p35S::SP-mCherry-GFP-HDEL was a gift from Joe McKenna (Addgene plasmid # 159097 ; http://n2t.net/addgene:159097 ; RRID:Addgene_159097) -
For your References section:
Maize (Zea mays L.) Nucleoskeletal Proteins Regulate Nuclear Envelope Remodeling and Function in Stomatal Complex Development and Pollen Viability. McKenna JF, Gumber HK, Turpin ZM, Jalovec AM, Kartick AC, Graumann K, Bass HW. Front Plant Sci. 2021 Feb 17;12:645218. doi: 10.3389/fpls.2021.645218. eCollection 2021. 10.3389/fpls.2021.645218 PubMed 33679862