pFastBac1-His10TEV
(Plasmid
#159427)
-
Purpose(Empty Backbone) empty pFastBac1 vector (polyhedrin promoter) adds TEV-protease-removable N-terminal His10-tag; avoids unwanted residues in the final protein sequence by using the BseRI restriction sites
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159427 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerInvitrogen
- Backbone size (bp) 4682
-
Modifications to backboneintroduced a silent mutation in the gentamyin-resistance gene in order to remove one BseRI site
-
Vector typeInsect Expression
- Promoter polyhedrin
-
Selectable markersGentamicin
-
Tag
/ Fusion Protein
- TEV-protease-cleavable His10-tag (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AAATGATAACCATCTCGC
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
- This vector is designed to avoid adding non-native amino acid residues to the protein of interest, following TEV protease cleavage of the N-terminal purification tag. Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTCTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, AGTACTTCTCGACAA, to the 5' end of the PCR REVERSE primer.
- The sequence of the N-terminus will be MGSS + His10 + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminus of the protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568.
- BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone.
- An unwanted BseRI site was removed from the parent pFastBac1 vector by introducing a silent mutation (CTC to CTG) in a leucine codon in the gentamicin-resistance gene.
- To identify colonies containing a cloned insert, used the primers PFASTBAC1F (CTAGTGGTTGGCTACGTATACTCCG) and PFASTBAC1R (GGACAAACCACAACTAGAATGCAGTG).
- To verify the PCR-generated insert sequence, use sequencing primers POLYHEDF (AAATGATAACCATCTCGC), SV40PAR (GAAATTTGTGATGCTATTGC).
- To verify Tn7-based incorporation of the expression construct into the bacmid DNA in the E. coli strain DH10Bac, use PCR primers BACM13F (CCCAGTCACGACGTTGTAAAACG) and BACM13R (AGCGGATAACAATTTCACACAGG). A bacmid containing the correct insert has a PCR product size of ~2300 base pairs plus the length of the added insert.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac1-His10TEV was a gift from Debra Hansen (Addgene plasmid # 159427 ; http://n2t.net/addgene:159427 ; RRID:Addgene_159427) -
For your References section:
Protein expression and purification of G-protein coupled receptor kinase 6 (GRK6), toward structure-based drug design and discovery for multiple myeloma. Olson TL, Zhang S, Labban D, Kaschner E, Aceves M, Iyer S, Meza D, Zook JD, Chun E, Craciunescu FM, Liu W, Shi CX, Stewart AK, Hansen DT, Meurice N, Fromme P. Protein Expr Purif. 2021 May 7:105890. doi: 10.1016/j.pep.2021.105890. 10.1016/j.pep.2021.105890 PubMed 33971243