Skip to main content

pcDNA3-P1-N-EGFP-C
(Plasmid #159436)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159436 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 159436-D50 50 μg of DNA in Tris buffer $495
DNA 159436-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3
  • Total vector size (bp) 6183
  • Vector type
    CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Insert Size (bp)
    696
  • Promoter CMV
  • Tags / Fusion Proteins
    • 5' linker pair 1 (N terminal on backbone)
    • N terminal peptide linker (N terminal on insert)
    • C terminal peptide linker (C terminal on insert)
    • 3' linker pair 1 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer GAAAGGACAGTGGGAGTGGCACCTTCCAGGGCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-P1-N-EGFP-C was a gift from Jianhua Xing (Addgene plasmid # 159436 ; http://n2t.net/addgene:159436 ; RRID:Addgene_159436)
  • For your References section:

    Rapid, modular, and cost-effective generation of donor DNA constructs for CRISPR-based gene knock-in. Chen YJ, Cheng YY, Wang W, Tian XJ, Lefever DE, Taft DA, Zhang J, Xing J. Biol Methods Protoc. 2020 Mar 20;5(1):bpaa006. doi: 10.1093/biomethods/bpaa006. eCollection 2020. 10.1093/biomethods/bpaa006 PubMed 32411820