pICH47802-p35S::tdTomato-ER::tNOS
(Plasmid
#160220)
-
PurposetdTomato fluorescent protein-ER localization, 35 promoter, tNOS terminator, transcriptional unit, inserted at the MoClo toolkit level 1 acceptor position 1 reverse
-
Depositing Lab
-
Depositing OrganizationUniversity of Florida
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160220 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepICH47802
- Backbone size w/o insert (bp) 4968
- Total vector size (bp) 6992
-
Vector typePlant Expression, Synthetic Biology ; MoClo toolkit level 1 acceptor position 1 reverse
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namep2x35S::TdTomato-ER::tNOS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site bsa1 (destroyed during cloning)
- 3′ cloning site bsa1 (destroyed during cloning)
- 5′ sequencing primer aacatggtggagcacgacact
- 3′ sequencing primer gatctagtaacatagatgacacc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICH47802-p35S::tdTomato-ER::tNOS was a gift from Matias Kirst (Addgene plasmid # 160220 ; http://n2t.net/addgene:160220 ; RRID:Addgene_160220) -
For your References section:
Simple, efficient and open-source CRISPR/Cas9 strategy for multi-site genome editing in Populus tremula x alba. Triozzi P, Schmidt HW, Dervinis C, Kirst M, Conde D. Tree Physiol. 2021 May 7. pii: 6270869. doi: 10.1093/treephys/tpab066. 10.1093/treephys/tpab066 PubMed 33960379