pICH47802-p35S::tdTomato-ER::tNOS
(Plasmid #160220)

• Purpose: tdTomato fluorescent protein-ER localization, 35 promoter, tNOS terminator, transcriptional unit, inserted at the MoClo toolkit level 1 acceptor position 1 reverse
• Depositing Lab: Matias Kirst
• Publication: Triozzi et al Tree Physiol. 2021 May 7. pii: 6270869. doi: 10.1093/treephys/tpab066.

Backbone

• Vector backbone: pICH47802
• Backbone size w/o insert (bp): 4968
• Total vector size (bp): 6992
• Vector type: Plant Expression, Synthetic Biology ; MoClo toolkit level 1 acceptor position 1 reverse

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: p2x35S::TdTomato-ER::tNOS

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: bsa1 (destroyed during cloning)
• 3′ cloning site: bsa1 (destroyed during cloning)
• 5′ sequencing primer: aacatggtggagcacgacact
• 3′ sequencing primer: gatctagtaacatagatgacacc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry