pEGB3 alpha1 P35S:PhiC31 integrase-RDF:T35S (GB2893)
(Plasmid
#160633)
-
PurposeTU for the constitutive expression of the PhiC31 integrase, C-terminally fused with its reversion factor (RDF)
-
Depositing Lab
-
Depositing OrganizationAgencia Estatal Consejo Superior de Investigaciones Científicas, M.P.
Located in Spain -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160633 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDGB3_alpha1
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePhiC31-RDF
-
SpeciesSynthetic
-
Insert Size (bp)3850
-
MutationBsaI and BsmBI sites removed
- Promoter 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GGTGGCAGGATATATTGTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsmBI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGB3 alpha1 P35S:PhiC31 integrase-RDF:T35S (GB2893) was a gift from Diego Orzaez (Addgene plasmid # 160633 ; http://n2t.net/addgene:160633 ; RRID:Addgene_160633) -
For your References section:
A memory switch for plant synthetic biology based on the phage varphiC31 integration system. Bernabe-Orts JM, Quijano-Rubio A, Vazquez-Vilar M, Mancheno-Bonillo J, Moles-Casas V, Selma S, Gianoglio S, Granell A, Orzaez D. Nucleic Acids Res. 2020 Apr 6;48(6):3379-3394. doi: 10.1093/nar/gkaa104. 10.1093/nar/gkaa104 PubMed 32083668