pDGB3 omega1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2235)
(Plasmid
#160646)
-
PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.
-
Depositing Lab
-
Depositing OrganizationAgencia Estatal Consejo Superior de Investigaciones Científicas, M.P.
Located in Spain -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160646 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 160646-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 160646-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGB3_omega1
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typeCRISPR
-
Selectable markerslacZ
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
-
SpeciesUnspecified
-
Insert Size (bp)9357
-
MutationBsaI and BsmBI sites removed
- Promoter Pnos, 35S, 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer caacctctcgggcttctgga
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsaI.
DNA (Catalog # 160646-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 160646-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3 omega1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2235) was a gift from Diego Orzaez (Addgene plasmid # 160646 ; http://n2t.net/addgene:160646 ; RRID:Addgene_160646) -
For your References section:
The GB4.0 Platform, an All-In-One Tool for CRISPR/Cas-Based Multiplex Genome Engineering in Plants. Vazquez-Vilar M, Garcia-Carpintero V, Selma S, Bernabe-Orts JM, Sanchez-Vicente J, Salazar-Sarasua B, Ressa A, de Paola C, Ajenjo M, Quintela JC, Fernandez-Del-Carmen A, Granell A, Orzaez D. Front Plant Sci. 2021 Jul 1;12:689937. doi: 10.3389/fpls.2021.689937. eCollection 2021. 10.3389/fpls.2021.689937 PubMed 34276739
