pcDNAFut9
(Plasmid
#161021)
-
Purposea fucosyltransferase 9 (Fut9) expression plasmid, containing full-length mouse Fut9 cloned into pcDNA3.1+
-
Depositing Lab
-
Depositing OrganizationRuhr-Universitaet Bochum
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 161021 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 161021-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 161021-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1+
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6513
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFucosyltransferase 9
-
Alt nameFut9
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1085
-
Entrez GeneFut9 (a.k.a. AI746471, AU067636, mFUT9, mFuc-TI, mFuc-TIX)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGATCCATGACATCAACATCCAAAGGC
- 3′ sequencing primer GAATTCTTAATTCCAAAACCATTTCTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Eva Hennen cloned full-length mouse Fut9 into the pcDNA3.1+ vector which was obtained from Invitrogen.
DNA (Catalog # 161021-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 161021-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNAFut9 was a gift from Andreas Faissner (Addgene plasmid # 161021 ; http://n2t.net/addgene:161021 ; RRID:Addgene_161021) -
For your References section:
Structurally distinct LewisX glycans distinguish subpopulations of neural stem/progenitor cells. Hennen E, Czopka T, Faissner A. J Biol Chem. 2011 May 6;286(18):16321-31. doi: 10.1074/jbc.M110.201095. Epub 2011 Mar 8. 10.1074/jbc.M110.201095 PubMed 21385876