CXCR4-SZ146a QTY
(Plasmid
#162443)
-
PurposeExpression in E coli and perform ligand binding in solution
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162443 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET20b
-
Modifications to backboneN/A
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC-X-C chemokine receptor type 4
-
Alt nameCD184
-
SpeciesH. sapiens (human)
-
Insert Size (bp)438
-
MutationAll L, I, V, F in the transmembrane region mutated to Q, T and Y, truncation from aa52 to aa245
-
GenBank IDNM_003467.3
-
Entrez GeneCXCR4 (a.k.a. CD184, D2S201E, FB22, HM89, HSY3RR, LAP-3, LAP3, LCR1, LESTR, NPY3R, NPYR, NPYRL, NPYY3R, WHIM, WHIMS, WHIMS1)
-
Tag
/ Fusion Protein
- his-tag, Rho-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer aagcccgaaaggaagctgagtt
- 3′ sequencing primer aactcagcttcctttcgggctt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CXCR4-SZ146a QTY was a gift from Shuguang Zhang (Addgene plasmid # 162443 ; http://n2t.net/addgene:162443 ; RRID:Addgene_162443) -
For your References section:
Non-full-length Water-Soluble CXCR4(QTY) and CCR5(QTY) Chemokine Receptors: Implication for Overlooked Truncated but Functional Membrane Receptors. Qing R, Tao F, Chatterjee P, Yang G, Han Q, Chung H, Ni J, Suter BP, Kubicek J, Maertens B, Schubert T, Blackburn C, Zhang S. iScience. 2020 Oct 28;23(12):101670. doi: 10.1016/j.isci.2020.101670. eCollection 2020 Dec 18. 10.1016/j.isci.2020.101670 PubMed 33376963