pJYDN2p
(Plasmid
#162455)
-
PurposePositive control plasmid for co-cultivation labeling by using designed ALFA-tag binding nanobody (DnbALFA).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162455 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneNew backbone pJYD
-
Backbone manufacturerDr. Jiri Zahradnik
- Backbone size w/o insert (bp) 5106
- Total vector size (bp) 5017
-
Vector typeShuttle vector bacteria/yeast
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAga2p-DnbALFA
-
Insert Size (bp)798
-
Entrez GeneAGA2 (a.k.a. YGL032C)
- Promoter GAL1
-
Tags
/ Fusion Proteins
- HA and myc (C terminal on insert)
- DnbALFA nanobody (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GaL1b_F primer: CCTCTATACTTTAACGTCAAGGAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.12.16.423176v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJYDN2p was a gift from Gideon Schreiber (Addgene plasmid # 162455 ; http://n2t.net/addgene:162455 ; RRID:Addgene_162455) -
For your References section:
An enhanced yeast display platform demonstrates the binding plasticity under various selection pressures. Zahradník J, Dey D, Marciano S, Schreiber G. bioRxiv Preprint 2020 10.1101/2020.12.16.423176