Skip to main content

pUE1-TSP-ORF68 R443A
(Plasmid #162652)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162652 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 162652-D50 50 μg of DNA in Tris buffer $495
DNA 162652-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pHEK293 Ultra Expression Vector I
  • Backbone manufacturer
    Takara
  • Backbone size w/o insert (bp) 4632
  • Total vector size (bp) 6033
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ORF68
  • Species
    KSHV (HHV-8)
  • Insert Size (bp)
    1401
  • Mutation
    Amino acid R443 mutated to alanine
  • Promoter CMV
  • Tag / Fusion Protein
    • N-terminal 2xStrep-Tag II and HRV 3C site (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GTCAAGAAGACAGGGCCAGGTTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUE1-TSP-ORF68 R443A was a gift from Britt Glaunsinger (Addgene plasmid # 162652 ; http://n2t.net/addgene:162652 ; RRID:Addgene_162652)
  • For your References section:

    A pentameric protein ring with novel architecture is required for herpesviral packaging. Didychuk AL, Gates SN, Gardner MR, Strong LM, Martin A, Glaunsinger BA. Elife. 2021 Feb 8;10. pii: 62261. doi: 10.7554/eLife.62261. 10.7554/eLife.62261 PubMed 33554858
Commonly requested with: