pmEos2-N1 GBP (GBP-mEos2)
(Plasmid
#162876)
-
PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with photoconvertable protein mEos2 to track GFP proteins of interest to perform Fluorescent intrabody Localization Microscopy
-
Depositing Lab
-
Depositing OrganizationUniversity of Queensland
Located in Australia -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162876 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 162876-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 162876-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmEos2-N1
-
Backbone manufacturerEGFP replaced with mEos2 in pEGFP-N1 backbone (Clontec)
- Backbone size w/o insert (bp) 3973
- Total vector size (bp) 5021
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP Binding Protein tagged with mEos2
-
Alt nameGBP, GFP Nanobody, abGFP4
-
Insert Size (bp)1048
-
Tag
/ Fusion Protein
- mEos2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (CMV F)
- 3′ sequencing primer TGTACCATCTCCGTCGATCA (mEos2 R)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGBP insert was derived from pOPINE GFP nanobody (Plasmid #49172)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 162876-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 162876-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmEos2-N1 GBP (GBP-mEos2) was a gift from Frederic Meunier (Addgene plasmid # 162876 ; http://n2t.net/addgene:162876 ; RRID:Addgene_162876) -
For your References section:
Modular transient nanoclustering of activated beta2-adrenergic receptors revealed by single-molecule tracking of conformation-specific nanobodies. Gormal RS, Padmanabhan P, Kasula R, Bademosi AT, Coakley S, Giacomotto J, Blum A, Joensuu M, Wallis TP, Lo HP, Budnar S, Rae J, Ferguson C, Bastiani M, Thomas WG, Pardon E, Steyaert J, Yap AS, Goodhill GJ, Hilliard MA, Parton RG, Meunier FA. Proc Natl Acad Sci U S A. 2020 Nov 19. pii: 2007443117. doi: 10.1073/pnas.2007443117. 10.1073/pnas.2007443117 PubMed 33214152
Map uploaded by the depositor.
