pEGFP-C1 PA-PLA1 (EGFP-PA-PLA1)
(Plasmid #162880)

• Purpose: Expression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with EGFP
• Depositing Lab: Frederic Meunier
• Publication: Gormal et al Proc Natl Acad Sci U S A. 2020 Nov 19. pii: 2007443117. doi: 10.1073/pnas.2007443117.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontec
• Backbone size w/o insert (bp): 4717
• Total vector size (bp): 7336
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Phosphatidic acid-preferring phospholipase A1 (PA-PLA1)
• Species: H. sapiens (human)
• Insert Size (bp): 2616
• GenBank ID: NM_030637.3
• Entrez Gene: DDHD1 (a.k.a. PA-PLA1, PAPLA1, SPG28)
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG (EGFP-C)
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC (SV40pA-R)

Resource Information

• Supplemental Documents:
  • pEGFP-C1 PA-PLA1 (EGFP-PA-PLA1).gbk
• A portion of this plasmid was derived from a plasmid made by: PA-PLA1 was sub-cloned from pFLAG-CMV2-PA-PLA1, a kind gift from Professor Katsuko Tani (Shimoi W, et al. (2005) p125 is localized in endoplasmic reticulum exit sites and involved in their organization. J Biol Chem 280(11):10141-10148).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry