Skip to main content

pEGFP-C1 PA-PLA1 (EGFP-PA-PLA1)
(Plasmid #162880)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162880 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontec
  • Backbone size w/o insert (bp) 4717
  • Total vector size (bp) 7336
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Phosphatidic acid-preferring phospholipase A1 (PA-PLA1)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2616
  • GenBank ID
    NM_030637.3
  • Entrez Gene
    DDHD1 (a.k.a. PA-PLA1, PAPLA1, SPG28)
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (EGFP-C)
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC (SV40pA-R)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PA-PLA1 was sub-cloned from pFLAG-CMV2-PA-PLA1, a kind gift from Professor Katsuko Tani (Shimoi W, et al. (2005) p125 is localized in endoplasmic reticulum exit sites and involved in their organization. J Biol Chem 280(11):10141-10148).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1 PA-PLA1 (EGFP-PA-PLA1) was a gift from Frederic Meunier (Addgene plasmid # 162880 ; http://n2t.net/addgene:162880 ; RRID:Addgene_162880)
  • For your References section:

    Modular transient nanoclustering of activated beta2-adrenergic receptors revealed by single-molecule tracking of conformation-specific nanobodies. Gormal RS, Padmanabhan P, Kasula R, Bademosi AT, Coakley S, Giacomotto J, Blum A, Joensuu M, Wallis TP, Lo HP, Budnar S, Rae J, Ferguson C, Bastiani M, Thomas WG, Pardon E, Steyaert J, Yap AS, Goodhill GJ, Hilliard MA, Parton RG, Meunier FA. Proc Natl Acad Sci U S A. 2020 Nov 19. pii: 2007443117. doi: 10.1073/pnas.2007443117. 10.1073/pnas.2007443117 PubMed 33214152