Skip to main content

pAT9750-BEAR-mCherry
(Plasmid #162990)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162990 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 162990-D50 50 μg of DNA in Tris buffer $495
DNA 162990-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry split with an intron between amino acids 119-120
  • Species
    Synthetic; disrupted 5' splice site
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAACGGGACTTTCCAAAATG
  • 3′ sequencing primer GGTTCAGGGGGAGGTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAT9750-BEAR-mCherry was a gift from Ervin Welker (Addgene plasmid # 162990 ; http://n2t.net/addgene:162990 ; RRID:Addgene_162990)
  • For your References section:

    BEAR reveals that increased fidelity variants can successfully reduce the mismatch tolerance of adenine but not cytosine base editors. Talas A, Simon DA, Kulcsar PI, Varga E, Krausz SL, Welker E. Nat Commun. 2021 Nov 3;12(1):6353. doi: 10.1038/s41467-021-26461-y. 10.1038/s41467-021-26461-y PubMed 34732717