Skip to main content

mouse KANK4 Ankyrin Repeats pET151
(Plasmid #164057)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164057 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pET151
  • Backbone size w/o insert (bp) 5760
  • Total vector size (bp) 6540
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kidney Ankyrin Repeat-Containing Protein 4
  • Alt name
    KANK 4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    790
  • Entrez Gene
    Kank4 (a.k.a. Ankrd38, C130031J23)
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag, TEV cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site Xhol (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.64898/2026.06.09.731086 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mouse KANK4 Ankyrin Repeats pET151 was a gift from Ben Goult (Addgene plasmid # 164057 ; http://n2t.net/addgene:164057 ; RRID:Addgene_164057)
  • For your References section:

    The KN domain of KANK proteins contains separable talin-binding and intramolecular interaction modules. Khan RB, Kallem T, Singh AK, Goult BT. bioRxiv 2026.06.09.731086 10.64898/2026.06.09.731086