pVER-LacI
(Plasmid
#164830)
-
PurposeLacI protein regulates expression of yellow fluorescent protein. For measuring dose-response curves.
-
Depositing Lab
-
Depositing OrganizationNational Institute of Standards and Technology
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 164830-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 164830-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepAN1818
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)MG1655dLac
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLacI
-
Alt namelac repressor
-
SpeciesE. coli
-
Insert Size (bp)1083
- Promoter Ptac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTCTCGGCATGGACGAGCTGT
- 3′ sequencing primer TGCAGCGAGTCAGTGAGCGAGGAAGCACCTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byderivative of pAN1818 plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from the pAN1818 plasmid from the Chris Voigt lab.
DNA (Catalog # 164830-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 164830-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVER-LacI was a gift from Drew Tack (Addgene plasmid # 164830 ; http://n2t.net/addgene:164830 ; RRID:Addgene_164830) -
For your References section:
The genotype-phenotype landscape of an allosteric protein. Tack DS, Tonner PD, Pressman A, Olson ND, Levy SF, Romantseva EF, Alperovich N, Vasilyeva O, Ross D. Mol Syst Biol. 2021 Mar;17(3):e10179. doi: 10.15252/msb.202010179. 10.15252/msb.202010179 PubMed 33784029