Skip to main content

pVER-LacI
(Plasmid #164830)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164830 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 164830-D50 50 μg of DNA in Tris buffer $495
DNA 164830-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pAN1818
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    MG1655dLac
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    LacI
  • Alt name
    lac repressor
  • Species
    E. coli
  • Insert Size (bp)
    1083
  • Promoter Ptac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTCTCGGCATGGACGAGCTGT
  • 3′ sequencing primer TGCAGCGAGTCAGTGAGCGAGGAAGCACCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    derivative of pAN1818 plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Derived from the pAN1818 plasmid from the Chris Voigt lab.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVER-LacI was a gift from Drew Tack (Addgene plasmid # 164830 ; http://n2t.net/addgene:164830 ; RRID:Addgene_164830)
  • For your References section:

    The genotype-phenotype landscape of an allosteric protein. Tack DS, Tonner PD, Pressman A, Olson ND, Levy SF, Romantseva EF, Alperovich N, Vasilyeva O, Ross D. Mol Syst Biol. 2021 Mar;17(3):e10179. doi: 10.15252/msb.202010179. 10.15252/msb.202010179 PubMed 33784029
Commonly requested with: