Skip to main content

MSCVpic2neo-EGFP-p16 shRNA
(Plasmid #164919)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164919 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    MSCVpic2
  • Backbone size w/o insert (bp) 7140
  • Total vector size (bp) 7882
  • Vector type
    Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Enhanced green fluorescent protein
  • Alt name
    EGFP
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • GenBank ID

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site FseI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer atggtgagcaagggcgagga
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    CDKN2A
  • Alt name
    p16
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    22
  • GenBank ID
    NM_000077.5
  • Entrez Gene
    CDKN2A (a.k.a. ARF, CAI2, CDK4I, CDKN2, CMM2, INK4, INK4A, MLM, MTS-1, MTS1, P14, P14ARF, P16, P16-INK4A, P16INK4, P16INK4A, P19, P19ARF, TP16)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho 1 (unknown if destroyed)
  • 3′ cloning site Eco R1 (unknown if destroyed)
  • 5′ sequencing primer gggataacagggtaattgtttgaatg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCVpic2neo-EGFP-p16 shRNA was a gift from Ji Luo (Addgene plasmid # 164919 ; http://n2t.net/addgene:164919 ; RRID:Addgene_164919)
  • For your References section:

    One-step immortalization of primary human airway epithelial cells capable of oncogenic transformation. Smith JL, Lee LC, Read A, Li Q, Yu B, Lee CS, Luo J. Cell Biosci. 2016 Nov 11;6:57. doi: 10.1186/s13578-016-0122-6. eCollection 2016. 10.1186/s13578-016-0122-6 PubMed 27891214