Skip to main content

pENTR-D-TOPO-kcnn1a
(Plasmid #164956)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164956 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pENTR-D-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2580
  • Total vector size (bp) 5253
  • Vector type
    PCR cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    kcnn1a
  • Alt name
    si:rp71-39b20.3
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    2673
  • Entrez Gene
    kcnn1a (a.k.a. si:rp71-39b20.3)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The DNA sequence was amplified from pooled wild-type TAB zebrafish embryos. According to the predicted sequence, XP_005171293.1, there are likely polymorphisms, K185E, H323Y, S599N, which are not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. In addition, at the 5’ end of the insert, there are 44bps extra forward primer dimer sequences (ATGCGGCATCGGCACGCGGGCCATGCGGCATCGGCACGCGGGCC) before the start codon. But this will not impact the result of the whole mount in situ hybridization.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR-D-TOPO-kcnn1a was a gift from GuangJun Zhang (Addgene plasmid # 164956 ; http://n2t.net/addgene:164956 ; RRID:Addgene_164956)
  • For your References section:

    Phylogenetic and developmental analyses indicate complex functions of Calcium-Activated Potassium Channels in zebrafish embryonic development. Silic MR, Black MM, Zhang G. Dev Dyn. 2021 Mar 16. doi: 10.1002/dvdy.329. 10.1002/dvdy.329 PubMed 33728688