pLJM1-TMEM192-FLAG
(Plasmid
#164977)
-
PurposeLentiviral vector for TMEM192 expression in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164977 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePLJM1
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTMEM192
-
SpeciesH. sapiens (human)
-
Insert Size (bp)813
-
Entrez GeneTMEM192
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CMV-Fwd: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GACGTGAAGAATGTGCGAGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-TMEM192-FLAG was a gift from Roberto Zoncu (Addgene plasmid # 164977 ; http://n2t.net/addgene:164977 ; RRID:Addgene_164977) -
For your References section:
NPC1-mTORC1 Signaling Couples Cholesterol Sensing to Organelle Homeostasis and Is a Targetable Pathway in Niemann-Pick Type C. Davis OB, Shin HR, Lim CY, Wu EY, Kukurugya M, Maher CF, Perera RM, Ordonez MP, Zoncu R. Dev Cell. 2020 Dec 7. pii: S1534-5807(20)30925-4. doi: 10.1016/j.devcel.2020.11.016. 10.1016/j.devcel.2020.11.016 PubMed 33308480