HCP5
(Plasmid
#166107)
-
PurposeThis plasmid encodes a Cas9 protein as well as a sgRNAs that targets the C-terminus of Cyr1.
-
Depositing Lab
-
Depositing OrganizationUniversity of Groningen
Located in the Netherlands -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166107 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepYTK103
-
Vector typeYeast Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCyr1CT-sgRNA
-
gRNA/shRNA sequenceACAAATGGTTAAGAACGCAA
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneCYR1 (a.k.a. YJL005W, CDC35, FIL1, HSR1, SRA4, TSM0185)
Cloning Information
- Cloning method Gateway Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HCP5 was a gift from Matthias Heinemann (Addgene plasmid # 166107 ; http://n2t.net/addgene:166107 ; RRID:Addgene_166107)