Skip to main content

Sec61b-V5-TurboID
(Plasmid #166971)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166971 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 166971-D50 50 μg of DNA in Tris buffer $495
DNA 166971-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA5
  • Backbone size w/o insert (bp) 5082
  • Total vector size (bp) 6393
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sec61b-V5-TurboID
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1311
  • GenBank ID
    NM_006808.2
  • Entrez Gene
    SEC61B
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • V5 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sec61b-V5-TurboID was a gift from Hyun-Woo Rhee (Addgene plasmid # 166971 ; http://n2t.net/addgene:166971 ; RRID:Addgene_166971)
  • For your References section:

    Dynamic tracking and identification of tissue-specific secretory proteins in the circulation of live mice. Kim KE, Park I, Kim J, Kang MG, Choi WG, Shin H, Kim JS, Rhee HW, Suh JM. Nat Commun. 2021 Sep 1;12(1):5204. doi: 10.1038/s41467-021-25546-y. 10.1038/s41467-021-25546-y PubMed 34471136