pSiMPls_N + pSiMPls_C
(Plasmid
#167203)
-
PurposeSiMPl plasmid pair (pSiMPls) for use with spectinomycin/streptomycin
-
Depositing Lab
-
Depositing OrganizationAlbert-Ludwigs-Universitaet Freiburg
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167203 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBAD33 + pTrc99a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionspSiMPls_N should be co-transformed with pSiMPls_C (or vice versa) in E. coli to get a reconstituted functional aminoglycoside adenylyltransferase thereby conferring resistance towards spectinomycin/streptomycin. The plasmids possess no additional antibiotic resistance gene. Please see the Sequences link for the individual plasmid sequences. An E. coli bacterial stab from Addgene will have both the plasmids pSiMPls_N + pSiMPls_C. Separating individual plasmid backbones will be possible via PCR. Agarose gel electrophoresis can be used to visualize the presence of both the plasmids. But, separating individual plasmids via gel electrophoresis, in our hands, always resulted in cross-contamination of the two backbones. mRuby3 gene was amplified from a construct bought by us from Addgene (ID: 74252).
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEGFP
-
Insert Size (bp)720
- Promoter pBAD
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer gcacggcgtcacactttgctatgcc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSmR 1-75 + gp41-1 N-intein
-
SpeciesSynthetic
-
Insert Size (bp)492
- Promoter CAT
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ccaactttcaccataatgaaataagatcactaccgggcg
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namemRuby3
-
Insert Size (bp)711
- Promoter pTrc
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer ttgacaattaatcatccggctcgtataatg
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namegp41-1 C-intein + SmR 76-263
-
SpeciesSynthetic
-
Insert Size (bp)678
- Promoter AmpR
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer NA
- 3′ sequencing primer gaagttttaaatcaatctaaagtatatatgag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pSiMPls_N should be co-transformed with pSiMPls_C (or vice versa) in E. coli to get a reconstituted functional aminoglycoside adenylyltransferase thereby conferring resistance towards spectinomycin/streptomycin. The plasmids possess no additional antibiotic resistance gene.
Please see the Sequences link for the individual plasmid sequences.
An E. coli bacterial stab from Addgene will have both the plasmids pSiMPls_N + pSiMPls_C. Separating individual plasmid backbones will be possible via PCR. Agarose gel electrophoresis can be used to visualize the presence of both the plasmids. But, separating individual plasmids via gel electrophoresis, in our hands, always resulted in cross-contamination of the two backbones.
mRuby3 gene was amplified from a construct bought by us from Addgene (ID: 74252).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSiMPls_N + pSiMPls_C was a gift from Barbara Di Ventura (Addgene plasmid # 167203 ; http://n2t.net/addgene:167203 ; RRID:Addgene_167203) -
For your References section:
Expanding the SiMPl Plasmid Toolbox for Use with Spectinomycin/Streptomycin. Palanisamy N, Ballestin JB, Di Ventura B. ACS Omega. 2021 May 21;6(22):14148-14153. doi: 10.1021/acsomega.1c00649. eCollection 2021 Jun 8. 10.1021/acsomega.1c00649 PubMed 34124437