Skip to main content

pSiMPls_N + pSiMPls_C
(Plasmid #167203)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167203 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBAD33 + pTrc99a
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    pSiMPls_N should be co-transformed with pSiMPls_C (or vice versa) in E. coli to get a reconstituted functional aminoglycoside adenylyltransferase thereby conferring resistance towards spectinomycin/streptomycin. The plasmids possess no additional antibiotic resistance gene. Please see the Sequences link for the individual plasmid sequences. An E. coli bacterial stab from Addgene will have both the plasmids pSiMPls_N + pSiMPls_C. Separating individual plasmid backbones will be possible via PCR. Agarose gel electrophoresis can be used to visualize the presence of both the plasmids. But, separating individual plasmids via gel electrophoresis, in our hands, always resulted in cross-contamination of the two backbones. mRuby3 gene was amplified from a construct bought by us from Addgene (ID: 74252).
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    EGFP
  • Insert Size (bp)
    720
  • Promoter pBAD

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer gcacggcgtcacactttgctatgcc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    SmR 1-75 + gp41-1 N-intein
  • Species
    Synthetic
  • Insert Size (bp)
    492
  • Promoter CAT

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    mRuby3
  • Insert Size (bp)
    711
  • Promoter pTrc

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer ttgacaattaatcatccggctcgtataatg
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    gp41-1 C-intein + SmR 76-263
  • Species
    Synthetic
  • Insert Size (bp)
    678
  • Promoter AmpR

Cloning Information for Gene/Insert 4

  • Cloning method Gibson Cloning
  • 5′ sequencing primer NA
  • 3′ sequencing primer gaagttttaaatcaatctaaagtatatatgag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pSiMPls_N should be co-transformed with pSiMPls_C (or vice versa) in E. coli to get a reconstituted functional aminoglycoside adenylyltransferase thereby conferring resistance towards spectinomycin/streptomycin. The plasmids possess no additional antibiotic resistance gene.

Please see the Sequences link for the individual plasmid sequences.

An E. coli bacterial stab from Addgene will have both the plasmids pSiMPls_N + pSiMPls_C. Separating individual plasmid backbones will be possible via PCR. Agarose gel electrophoresis can be used to visualize the presence of both the plasmids. But, separating individual plasmids via gel electrophoresis, in our hands, always resulted in cross-contamination of the two backbones.

mRuby3 gene was amplified from a construct bought by us from Addgene (ID: 74252).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSiMPls_N + pSiMPls_C was a gift from Barbara Di Ventura (Addgene plasmid # 167203 ; http://n2t.net/addgene:167203 ; RRID:Addgene_167203)
  • For your References section:

    Expanding the SiMPl Plasmid Toolbox for Use with Spectinomycin/Streptomycin. Palanisamy N, Ballestin JB, Di Ventura B. ACS Omega. 2021 May 21;6(22):14148-14153. doi: 10.1021/acsomega.1c00649. eCollection 2021 Jun 8. 10.1021/acsomega.1c00649 PubMed 34124437
Commonly requested with: