pTRE-SOX17-P2A-Venus-rpEF1a-Zeo
(Plasmid
#169174)
-
PurposepiggyBac transposon to generate a Tet inducible SOX17 expressing cell line. Tet-On inducible when paired with #169175
-
Depositing Lab
-
Depositing OrganizationUniversity of Wisconsin, Madison
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169174 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneSPB-007
-
Backbone manufacturerTransposagen Bio
- Total vector size (bp) 9283
-
Modifications to backboneSOX17 downstream of TREtight promoter, along with Zeocin resistance gene driven by the EF1α promoter, are subcloned between ends of two ITRs of the transposon vector. SOX17 is linked with Venus through a P2A, with GSG linker, self-cleaving peptide sequence to allow for easy monitoring of transgene expression following addition of doxycycline to cell cultures.
-
Vector typeMammalian Expression ; piggyBac transposon
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOX17-P2A-Venus
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2034
-
GenBank IDNM_022454.4
-
Entrez GeneSOX17 (a.k.a. VUR3)
- Promoter pTREtight (tet-inducible promoter)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTGTAACCATTATAAGCTGC, TAGAAGGCACAGTCGAGG
- 3′ sequencing primer AAAAAGCCATACCAATGGGCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For use in Tet inducible expression systems:
The use of two different antibiotic-resistance genes allows for the selection of clones that incorporate the two vectors in a single step. Although all transgene sequences for conditional gene expression could be potentially cloned into a single plasmid, a two plasmid system provides more flexibility and permits the adjustment of the TRE/M2rtTA ratio to optimize hPSC generation with robust DOX-dependent gene expression, while avoiding transgene leakage.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE-SOX17-P2A-Venus-rpEF1a-Zeo was a gift from Igor Slukvin (Addgene plasmid # 169174 ; http://n2t.net/addgene:169174 ; RRID:Addgene_169174) -
For your References section:
SOX17 integrates HOXA and arterial programs in hemogenic endothelium to drive definitive lympho-myeloid hematopoiesis. Jung HS, Uenishi G, Park MA, Liu P, Suknuntha K, Raymond M, Choi YJ, Thomson JA, Ong IM, Slukvin II. Cell Rep. 2021 Feb 16;34(7):108758. doi: 10.1016/j.celrep.2021.108758. 10.1016/j.celrep.2021.108758 PubMed 33596423