pLV.U6.gDNMT1.Cas9-T2A-GFP
(Plasmid
#170362)
-
PurposePlasmid used for Crispr/cas9 based disruption of human DNMT1.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170362 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLV
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9-T2A-GFP
-
gRNA/shRNA sequencegatgtgggaccctgcggccc
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer taggtcttgaaaggagtggg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV.U6.gDNMT1.Cas9-T2A-GFP was a gift from Johan Jakobsson (Addgene plasmid # 170362 ; http://n2t.net/addgene:170362 ; RRID:Addgene_170362) -
For your References section:
Activation of neuronal genes via LINE-1 elements upon global DNA demethylation in human neural progenitors. Jonsson ME, Ludvik Brattas P, Gustafsson C, Petri R, Yudovich D, Pircs K, Verschuere S, Madsen S, Hansson J, Larsson J, Mansson R, Meissner A, Jakobsson J. Nat Commun. 2019 Jul 18;10(1):3182. doi: 10.1038/s41467-019-11150-8. 10.1038/s41467-019-11150-8 PubMed 31320637